(b) What was the significance of each ?
(b) Griffith showed that a transforming substance existed whereas Avery, MacLeod and McCarty proved that it is DNA.
If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.