(b) What was the significance of each ?
1. Pentose sugar (Deoxyribose in DNA and Ribose sugar in RNA.)
2. Phosphate group .
3. Nitrogenous bases which are of two types Purines- Adenine (A) , Guanine (G) and
Pyrimidines-Cytosine (C), Thymine (T) and Uracil (U).
If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.