(b) What was the significance of each ?
If a double stranded DNA has 20 per cent of cytosine, calculate the percent of adenine in the DNA.
5’– ATGCATGCATGCATGCATGCATGCATGC –3’ Write down the sequence of mRNA.
(1) In DNA molecule, A — T base pairs equal in number to G — C base pairs.
(2) A + G = T + C, i.e. Purines and pyrimidines equal in amount.
(3) A = T and C = G (Amount).
(4) The base ratio A + T/G + C may vary from one species to other but is constant for each species. It helps in identifying the source of DNA.
(5) The deoxyribose sugar and phosphate component occur in equal proportions.